nicholsnicole38 nicholsnicole38

03-10-2020
Social Studies

contestada

The United States primarily uses which type of government

Respuesta :

Monkeyfeet Monkeyfeet

03-10-2020

Answer:

Federalism

Explanation:

Answer Link

Otras preguntas

The Ak Uk O Jeesh, or The Groundhog Family. An Odjibwa Fable. by Henry Schoolcraft A female akukojeesh, or groundhog, with a numerous family of young ones, was

Which of the following would provide the first codon?mRNA: UUCAAUGCCUCAAGGUUAAAGCGGCGGUUCCCUGGCAUG

Translate the problem into a mathematical sentence, using p your variablename. Janet went to the grocery store Thursday night and spent $20.27. She paid$2.01 on

Round 7952 to the nearest thousand. Enter your answer in the box below.

what was the sum of all sales made during september 2015? a sale amount is defined as (quantity*saleprice).

An oil tank is being filled at a constant rate. The depth of the oil is a function of the number of minutes the tank has been filling, as shown in the table. Fi

A particular color of light has a wavelength of 442 nanometers in free space. What is the frequency of this color of light?(a) 6.79 x 10^14 Hz(b) 6.79 X 10^5 Hz

Look at the image shown. H-H What does this image represent? a Linear molecule with one domain Linear molecule with two domains Tetrahedral molecule with four d

when studying roots, you most often see square roots and cube roots; only occasionally do you see the fourth or fifth root. however, it can be interesting to co

a company that sells peanut butter in cylindrical jars. marketing research suggests that using wider jars will increase sales. suppose that the diameter of the

Q&A Education