SnigdhaV660500 SnigdhaV660500

04-11-2022
Biology

contestada

Which of the following would provide the first codon?mRNA: UUCAAUGCCUCAAGGUUAAAGCGGCGGUUCCCUGGCAUG

Respuesta :

RosaleighB446534 RosaleighB446534

04-11-2022

Cells decode mRNAs by reading their nucleotides in groups of three, called codons.

-One "start" codon, AUG, marks the beginning of a protein and also encodes the amino acid methionine

UUCAAUGCCUCAAGGUUAAAGCGGCGG

So the first codon would be AUG

Answer Link

Otras preguntas

As an artist, how would you decide which medium you are going to use? Would it depend more on the subject of your art piece or the tone (feeling) you hope to cr

Law of Syllogism to give valid conclusion. 6. Given: If it is raining, then I will bring my umbrella. If I do not bring my umbrella, then I do not need my rain

Read each example and choose the best answer. There is only ONE correct answer. The students are as busy as bees!? Metaphor Simile Personification Rhyme

The forces of attraction that exist between nonpolar molecules are called

Which of the following would be most important to a human geographer?

Bre’anna has $1,125 in her checking account, owes $800 on her credit card, and has a car worth $3,500 that is paid off. What are the total amounts of Bre’anna’s

Which LIQUID is the most dense? lamp oil milk water honey

what is mass? what is it standard unit?

What impact did technology have on the movies? Improved movies helped to end discrimination. Sound was added as well as color. Movies were replaced by vaudevill

The writers of the U.S. Constitution were most positively influenced by: A. King George’s words. B. American Indian tribes. C. Religious teachings D. Enlighten

Q&A Education