Isabella10
Isabella10
03-11-2015
Mathematics
contestada
5 consecutive intergers whose sum is 195
Respuesta :
TSO
TSO
03-11-2015
x + (x+1) + (x+2) + (x+3) + (x+4) = 195
5x + 10 = 195
5(x+2) = 195
x + 2 = 39
x = 37
The 5 consecutive integers whose sum is 195 are
37, 38, 39, 40, 41
.
Answer Link
VER TODAS LAS RESPUESTAS ( 36+ )
Otras preguntas
When you multiply a number by 1 4 , the result is A) 50% of the original number. B) 400% of the original number. C) four times the original number. D) one
Read this sonnet, and then complete the sentences that follow. Sonnet 4 by Edmund Spenser Be not dismayed that her unmoved mind Doth still persist in her rebel
Lynda is flying her kite at the end of a 40m string. The string makes and angle of pie/4 with the ground. The wind speed increases and the kite flies higher unt
Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTA
A marble is drawn at random from the bag shown below. The bag contains 3 green, 4 yellow, 5 blue, and 8 pink marbles. What is P(not pink)?
How does a person’s sense of self change from infancy to age 7 or 8 and from ages 10 to 11 into the teenage years?
Is the benefit gained by each individual in a mutualistic relationship equal? Why or why not?
Explain the resonance structures for the sulfite ion, SO32_. I said It consists of one carbon atom surrounded by three oxygen atoms, in a trigonal planar arrang
The APR of Lillian's savings account is 3.4%, and interest is compounded semiannually. If Lillian makes no additional deposits or withdrawals for an entire year
Find the vertex of the parabola whose equation is y = x^2 + 2x + 9.
