saraenyeart3649 saraenyeart3649

05-10-2017
Chemistry

contestada

What mass of naoh (40.0 g/mol) is needed to prepare 250 ml of 2 m naoh solution?

Respuesta :

mrsonicspiral6 mrsonicspiral6

09-10-2017

20 grams is probably the mass

Answer Link

Otras preguntas

an rv campground has 150 campsites with electrical power. twenty-five of the campsites are reserved as tent sites. how many sites are required to have a 30-amp,

Creating compelling visuals for presentations requires people to learn what new tools?.

Change the DNA to show 3 examples of wobble. Include the mRNA sequence and amino acid chain. CGTAGATCGATCGATCGCTGACTACGATCGACTGCTCGTCAGATAACGTACGTA

In part III of the statute, Jefferson concedes that no law, not even this one, is “irrevocable”; he then declares that infringing on the principles in the statu

display ads lets advertisers upload their own ads to the system, allowing advertisers greater control over the look and feel of their messaging. what are the tw

you are currently logged in using the badams account. you want to view the contents of the /etc/inittab file, but you are not allowed to with the badams account

(-6) • (-2) what is it the

doug believes rock stars are the most important spokespersons of his generation. this is an example of multiple choice question. predetermination. an attitude.

the police hypothesized that the mean speed of vehicles over the bridge would be the speed limit, 80 km/h. taking a significance level of 5 %, what should infer

(a) at point a or point b is the gradient vector more horizontal? why? (b) at point a or point b is the gradient vector longer? why?

Q&A Education