This question refers to the mRNA sequence below:

5' - A G C U G A U G G G C U G G U G C C G A G A A A G U U A G G U A A - 3'

As this mRNA is translated, the fifth codon is ___. Fill in the blank with the correct codon without any spaces, and nothing else so that Moodle can grade this question correctly.

Respuesta :

Answer:

Serine

Explanation:

The genetic code indicates the way by which the four bases of the messenger RNA (i.e., Adenine, Uracil, Guanine and Cytosine) are read in the ribosome to convert them into a protein. In this code, each codon is composed of three nucleotides that encode a single amino acid. Serine (S) residue can be synthesized by AGC (as in this case), AGU, UCA, UCC, UCG and UCU codons. The sequence above indicated (AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA) will be traduced in the following 5'-3' Frame:  S-WAGAEKVR-, where the second codon is a stop codon (UGA).

Q&A Education