mirianplacencia27 mirianplacencia27

05-02-2019
Mathematics

contestada

Kala used 22.74 gallons of fuel while driving. Now, 5.5 gallons are left. How much fuel did kala’s car have before her trip ?

Respuesta :

mullisjbo mullisjbo

05-02-2019

Answer:

28.24

Step-by-step explanation:

22.74+5.5

Answer Link

rachelbohlen rachelbohlen

05-02-2019

The answer is 28.24 since 22.74+5.5=28.4

Answer Link

Otras preguntas

In a class of 7, there are 3 students who have done their homework. If the teacher chooses 3 students, what is the probability that none of the three students h

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

great Britain is an example of a core nation True or False

Find f(x) if it is known that f(x−2)=2x−4.

Using the images or terms, describe how parts of a cell interact to export proteins.

The sum of two numbers is 69. The larger number is three less than twice the smaller number. Find the numbers. Show your work.

FIRST ONE TO ANSWER CORRECT GETS BRAINLYIST! Which characteristics of Dickinson’s style are evident in "The Snow”? Check all that apply. - four-line stanzas -

Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2

When a red blood cell is placed in hypotonic (very dilute) solutions of nacl?

I know you would not mind if we could fight and wrest the scepter from your hands. you know that we are powerless to do that, for you have ensured our incapacit

Q&A Education