Below is an alignment of DNA sequences from the same locus in 5 different species. From this information, which of the following statements is true?
1. gatttttttggggtccccacatgtactca
2. gatttctctccgggtaacgacatgtattee
3. gatttctctccgggtaacgacatgtatteg
4. gatttetett gtcccgacatgtanteg
5. gatttctctt ggtcoggacatgtaatee
a) The DNA sequences in all 5 species are identical.
b) The DNA sequences in all 5 species are different.
c) The DNA sequences in some species are identical, while in others they are different.
d) The DNA sequences cannot be determined from the given information.