garciaM17171 garciaM17171

03-01-2024
Computers and Technology

contestada

Identify the value of i for which the skew array of "GATACACTTCCCGAGTAGGTACTG" attains a minimum value. Report the position of the first occurrence only, with 1-based numeration with respect to the Genome (i.e., Skew[1] corresponds to "G" here)

Respuesta :

Otras preguntas

The management of an organization can push its employees closer to a union by: A. Interpreting the silence of the work force as indicating the absence of proble

What mass of salt (NaCl) should you add to 1.06 L of water in an ice cream maker to make a solution that freezes at -11.0 ∘C ? Assume complete dissociation of t

A bicyclist bikes the 90 mi to a city averaging a certain speed. The return trip is made at a speed that is 1 mph slower. Total time for the round trip is 19 hr

Determine the rate law and the value of k for the following reaction using the data provided. 2 NO(g) + O2(g) 2 NO2(g) [NO]i (M) [O2]i (M) Initial Rate (M-1s-1

A makeshift swing is constructed by making a loop in one end of a rope and tying the other end to a tree limb. A child is sitting in the loop with the rope hang

Currently perhaps the most famous cultural-awareness play is Tony Kushner's Pulizer Prize-winning __________________, which tells the interwoven stories of seve

A gyroscope flywheel of radius 3.21 cm is accelerated from rest at 13.2 rad/s2 until its angular speed is 2450 rev/min. (a) What is the tangential acceleration

State the Huygens-Fresnel principle. (b) What device is used to collect the data in this experiment? (c) Plane waves are incident on a slit whose width is adjus

As you are driving to Montgomery College, you notice a panhandler on a street corner. Instead of immediately assuming this person is lazy, you think that perhap

The difference between social media monitoring and private communities is that in social media research _____. a. the primary purpose is research b. researchers

Q&A Education